Locus MODY8 CEL
Suggest EditDisease
–
Name Maturity-Onset Diabetes of the Young Type 8
Inheritance
Description Maturity-onset diabetes of the young type 8 (MODY8) is characterized by onset of diabetes before age 25 years, with slowly progressive pancreatic exocrine dysfunction, fatty replacement of pancreatic parenchyma (lipomatosis), and development of pancreatic cysts1 . Other types of this disease have been associated with various genes and variant types, notably whole gene or whole exon deletions2 . In some CEL VNTR deletion carriers, chronic pancreatitis may precede diabetes, and one reported family had hereditary pancreatitis as the predominant phenotype3 . Comorbidity has been proposed between MODY and fecal elastase deficiency (FED)4 .
Age of Onset 11-176
HPO Terms
–
Association
Mendelian
Locus
Details The locus contains 17 imperfect 33 bp motifs, with a stretch of 7 perfect GGCCCCCCCCGTGCCGCCCACGGGTGACTCCGG motifs. Several pathogenic mutations have been proposed. The most supported pathogenic variants are single base deletions in the proximal VNTR, reported in repeat segments 1, 4, and 53 . One reported proximal VNTR deletion is a 1bp deletion of (C)8 to (C)7 within the VNTR, causing a motif change (this is the pathogenic motif represented here). Distal CEL VNTR single-base insertions, particularly INS9/INS10/INS12, have been reported as likely benign polymorphisms, while proximal insertion variants may have greater pathogenic potential7 . Also, a contraction that deletes one of the VNTR repeats may be pathogenic, with reduced penetrance, although evidence for this is sparse6 . Another study identified a c.2041_2042delinsCGG p.(Val681Argfs*6) mutation in the 12th motif (one of the imperfect motifs)8 . Several non-tandem repeat pathogenic MODY variants have also been reported in this gene. Given limited data and multiple proposed pathogenic variants, the normal and pathogenic ranges are currently difficult to define.
Mechanism Proximal CEL VNTR frameshift variants alter the C-terminal tandem-repeat domain and become pathogenic through protein misfolding and proteotoxic gain-of-function. Pathogenic proximal deletion variants show increased aggregation, reduced secretion, ER stress, and unfolded protein response, while enzymatic activity is largely preserved9,10,11 . Functional testing of CEL VNTR insertion variants showed that proximal insertions had greater aggregation and UPR effects7 .
GoF
Detection
Year Year first published 2005
Location in Gene
Exon 11
Gene Strand
Alleles
Ref. Motif Reference motif, reference orientation
GGCCCCCCCCGTGCCGCCCACGGGTGACTCCGG
Ranges
Benign (ref.) Benign motif, reference orientation
–
Benign (gene) Benign motif, gene orientation
–
Pathogenic (ref.) Pathogenic motif, reference orientation
ACGGGTGACTCCGGGGCCCCCCCGTGCCGCCC
Pathogen. (gene) Pathogenic motif, gene orientation
ACGGGTGACTCCGGGGCCCCCCCGTGCCGCCC
Unknown (ref.) Unknown motif, reference orientation
–
Unknown (gene) Unknown motif, gene orientation
–
Interruption (ref.) Interruption motif, reference orientation
–
Interrup. (gene) Interruption motif, gene orientation
–
References
Direct supporting references for info on this page.
3
Two New Mutations in the CEL Gene Causing Diabetes and Hereditary Pancreatitis: How to Correctly Identify MODY8 Cases.
Khadija,El Jellas, Petra,Dušátková, Ingfrid S,Haldorsen, Janne,Molnes, Erling,Tjora, Bente B,Johansson, Karianne,Fjeld, Stefan,Johansson, Štěpánka,Průhová, Leif,Groop, J Matthias,Löhr, Pål R,Njølstad, Anders,Molven
The Journal of clinical endocrinology and metabolism · 2022-03-24
pmid:348500195
Mutations in the CEL VNTR cause a syndrome of diabetes and pancreatic exocrine dysfunction.
Helge,Raeder, Stefan,Johansson, Pål I,Holm, Ingfrid S,Haldorsen, Eric,Mas, Véronique,Sbarra, Ingrid,Nermoen, Stig A,Eide, Louise,Grevle, Lise,Bjørkhaug, Jørn V,Sagen, Lage,Aksnes, Oddmund,Søvik, Dominique,Lombardo, Anders,Molven, Pål Rasmus,Njølstad
Nature genetics · 2005-12-20
pmid:163695316
Mutations in the VNTR of the carboxyl-ester lipase gene (CEL) are a rare cause of monogenic diabetes.
Janniche,Torsvik, Stefan,Johansson, Anders,Johansen, Jakob,Ek, Jayne,Minton, Helge,Raeder, Sian,Ellard, Andrew,Hattersley, Oluf,Pedersen, Torben,Hansen, Anders,Molven, Pål R,Njølstad
Human genetics · 2009-09-17
pmid:197602657
Common single-base insertions in the VNTR of the carboxyl ester lipase (CEL) gene are benign and also likely to arise somatically in the exocrine pancreas.
Ranveig S,Brekke, Anny,Gravdal, Khadija,El Jellas, Grace E,Curry, Jianguo,Lin, Steven J,Wilhelm, Solrun J,Steine, Eric,Mas, Stefan,Johansson, Mark E,Lowe, Bente B,Johansson, Xunjun,Xiao, Karianne,Fjeld, Anders,Molven
Human molecular genetics · 2024-05-18
pmid:384833488
Unraveling the genetic basis of MODY: insights from next-generation sequencing.
Metin,Eser, Gulam,Hekimoglu, Fatma,Dursun
Journal of applied genetics · 2024-10-03
pmid:393611229
Diabetes and pancreatic exocrine dysfunction due to mutations in the carboxyl ester lipase gene-maturity onset diabetes of the young (CEL-MODY): a protein misfolding disease.
Bente B,Johansson, Janniche,Torsvik, Lise,Bjørkhaug, Mette,Vesterhus, Anja,Ragvin, Erling,Tjora, Karianne,Fjeld, Dag,Hoem, Stefan,Johansson, Helge,Ræder, Susanne,Lindquist, Olle,Hernell, Miriam,Cnop, Jaakko,Saraste, Torgeir,Flatmark, Anders,Molven, Pål R,Njølstad
The Journal of biological chemistry · 2011-07-22
pmid:2178484210
A Carboxyl Ester Lipase (CEL) Mutant Causes Chronic Pancreatitis by Forming Intracellular Aggregates That Activate Apoptosis.
Xunjun,Xiao, Gabrielle,Jones, Wednesday A,Sevilla, Donna B,Stolz, Kelsey E,Magee, Margaret,Haughney, Amitava,Mukherjee, Yan,Wang, Mark E,Lowe
The Journal of biological chemistry · 2016-09-20
pmid:2765049911
The position of single-base deletions in the VNTR sequence of the carboxyl ester lipase (CEL) gene determines proteotoxicity.
Anny,Gravdal, Xunjun,Xiao, Miriam,Cnop, Khadija,El Jellas, Stefan,Johansson, Pål R,Njølstad, Mark E,Lowe, Bente B,Johansson, Anders,Molven, Karianne,Fjeld
The Journal of biological chemistry · 2021-04-14
pmid:33862081Additional Literature
Additional literature related to this locus.
Raw PubMed search results
(All PubMed results returned by searching for this gene, tandem
repeats, and disease, in medline format)
Dexamethasone prophylaxis for excessive lymphocyte expansion after cilta-cel in multiple myeloma.
Peter A,Forsberg, Jacqueline A,Turner, Marita,Meyer, Diana,Abbott, Sara,Nicholson, Henning,Schade, Jeffrey,Matous, Tara,Gregory
Blood advances · 2026-05-26
pmid:41894686Routine Monitoring of CAR-T-Cells Expansion and Persistence in Patients With Aggressive Large B-Cell Lymphoma by Flow Cytometry: A Single-Center Experience.
Alexandra,Zduniak, Jérémie,Martinet, Emilie,Lévêque, Stéphanie,Becker, David,Tonnelet, Elodie Dos,Santos, Claire,Leroy, Mustafa,Alani, Jean,Rouvet, Marine,Brousseau, Camille,Giverne, Alexis,Cuffel, Serge,Jacquot, Arnaud,Roucheux, Alice,Veuiller, Nicolas,Lecornu, Misa Eugene,Norbert, Olivier,Boyer, Hervé,Tilly, Fabrice,Jardin, Jean-Baptiste,Latouche, Vincent,Camus
Hematological oncology · 2025-11-01
pmid:41057236Early-onset diabetes with low utilization of lipid as an energy source carrying a rare missense mutation in the CEL gene.
Ayana,Fujii, Hiroko,Nakabayashi, Yuko,Nagao, Masaru,Akiyama, Akihiko,Taguchi, Kaito,Yorimoto, Risako,Hamada, Issei,Saeki, Naoki,Yamamoto, Taro,Takami, Kenji,Watanabe, Yoichi,Mizukami, Yasuharu,Ohta
Endocrinology, diabetes & metabolism case reports · 2025-08-18
pmid:40840513Characterizing Cellular Expansion of Idecabtagene Vicleucel and Association with Clinical Efficacy and Safety in Patients with Triple-Class-Exposed Relapsed/Refractory Multiple Myeloma.
Fan,Wu, Xirong,Zheng, Joseph,Burnett, Madhan,Masilamani, Wanying,Zhang, Xiaobo,Zhong, Andrea,Caia, Mark,Cook, Julia,Piasecki, Anna,Kondic, Manisha,Lamba, Jian,Zhou
Journal of clinical pharmacology · 2025-07-10
pmid:40641008Brexucabtagene autoleucel in-vivo expansion and BTKi refractoriness have a negative influence on progression-free survival in mantle cell lymphoma: Results from CART-SIE study.
Federico,Stella, Annalisa,Chiappella, Martina,Magni, Francesca,Bonifazi, Chiara,De Philippis, Maurizio,Musso, Ilaria,Cutini, Silva,Ljevar, Anna Maria,Barbui, Mirko,Farina, Massimo,Martino, Massimo,Massaia, Giovanni,Grillo, Piera,Angelillo, Barbara,Botto, Francesca,Patriarca, Mauro,Krampera, Luca,Arcaini, Maria Chiara,Tisi, Pierluigi,Zinzani, Federica,Sorà, Stefania,Bramanti, Martina,Pennisi, Cristiana,Carniti, Paolo,Corradini
British journal of haematology · 2024-12-22
pmid:39710966Common single-base insertions in the VNTR of the carboxyl ester lipase (CEL) gene are benign and also likely to arise somatically in the exocrine pancreas.
Ranveig S,Brekke, Anny,Gravdal, Khadija,El Jellas, Grace E,Curry, Jianguo,Lin, Steven J,Wilhelm, Solrun J,Steine, Eric,Mas, Stefan,Johansson, Mark E,Lowe, Bente B,Johansson, Xunjun,Xiao, Karianne,Fjeld, Anders,Molven
Human molecular genetics · 2024-05-18
pmid:38483348Unlocking Predictive Power: Quantitative Assessment of CAR-T Expansion with Digital Droplet Polymerase Chain Reaction (ddPCR).
Eugenio,Galli, Marcello,Viscovo, Federica,Fosso, Ilaria,Pansini, Giacomo,Di Cesare, Camilla,Iacovelli, Elena,Maiolo, Federica,Sorà, Stefan,Hohaus, Simona,Sica, Silvia,Bellesi, Patrizia,Chiusolo
International journal of molecular sciences · 2024-02-26
pmid:38473919Early Chimeric Antigen Receptor T Cell Expansion Is Associated with Prolonged Progression-Free Survival for Patients with Relapsed/Refractory Multiple Myeloma Treated with Ide-Cel: A Retrospective Monocentric Study.
Leo,Caillot, Emmanuel,Sleiman, Ingrid,Lafon, Marie-Lorraine,Chretien, Pauline,Gueneau, Alexandre,Payssot, Romain,Pedri, Daniela,Lakomy, François,Bailly, Julien,Guy, Jean-Pierre,Quenot, Herve,Avet-Loiseau, Denis,Caillot
Transplantation and cellular therapy · 2024-03-07
pmid:38458477The genetic risk factor CEL-HYB1 causes proteotoxicity and chronic pancreatitis in mice.
Karianne,Fjeld, Anny,Gravdal, Ranveig S,Brekke, Jahedul,Alam, Steven J,Wilhelm, Khadija,El Jellas, Helene N,Pettersen, Jianguo,Lin, Marie H,Solheim, Solrun J,Steine, Bente B,Johansson, Pål R,Njølstad, Caroline S,Verbeke, Xunjun,Xiao, Mark E,Lowe, Anders,Molven
Pancreatology : official journal of the International Association of Pancreatology (IAP) ... [et al.] · 2022-11-09
pmid:36379850